#505 Are these separate species according to

Are these separate species according to - Biology

ChemistryExplain daily providing Q&A content “#505 Are these separate species according to" in Biology scientists, Cell and molecular biology, Molecular and cellular biology, Biology, Ap biology review, Apologia biology

Get the Free Online Chemistry Q&A Questions And Answers with explain. To crack any examinations and Interview tests these Chemistry Questions And Answers are very useful. Here we have uploaded the Free Online Chemistry Questions. Here we are also given the all chemistry topic.

 ChemistryExplain team has covered all Topics related to inorganic, organic, physical chemistry, and others So, Prepare these Chemistry Questions and Answers with Explanation Pdf.

For More Chegg Questions

• Inorganic Chemistry
• Organic Chemistry
• Physical Chemistry

Join Our Telegram Channel for Covers All Update by ChemistryExplain:- Click Now

Free Chegg Question

Are these separate species according to each Species Concept?

Free Chegg AnswerFor More Chemistry Notes and Helpful Content Subscribe Our YouTube Chanel - Chemistry Explain  

Free Chegg Answer

There is some species separate by its species concepts or not and also noted it's mode of speciation if they separate it's special mode.

 

#504 How would you construct species groups

How would you construct species groups - Biology

ChemistryExplain daily providing Q&A content “#504 How would you construct species groups" in Biology scientists, Cell and molecular biology, Molecular and cellular biology, Biology, Ap biology review, Apologia biology

Get the Free Online Chemistry Q&A Questions And Answers with explain. To crack any examinations and Interview tests these Chemistry Questions And Answers are very useful. Here we have uploaded the Free Online Chemistry Questions. Here we are also given the all chemistry topic.

 ChemistryExplain team has covered all Topics related to inorganic, organic, physical chemistry, and others So, Prepare these Chemistry Questions and Answers with Explanation Pdf.

For More Chegg Questions

• Inorganic Chemistry
• Organic Chemistry
• Physical Chemistry

Join Our Telegram Channel for Covers All Update by ChemistryExplain:- Click Now

Free Chegg Question

1. How would you construct species groups from the given Trogloderus data for each species concept? There are many ways to do this, I would suggest using colored boxes (one color = one species). I provide an example below for the phylogenetic species concept (please delete my boxes, I made them incorrect on purpose).
2. What criteria did you use to delineate species boundaries for each species concept, and were they consistent for each of the specimens?
3. Which species concept seem to make the most sense for this group? Does your species concept allow you to organize Trogloderus spp. into reasonable groups if you were to submit your findings for publication? Why or why not?

Male Genitalia – Insect male genitalia is one of the most used systems to separate closely related species. This is sometimes called “Lock and Key” reproductive isolation, and is used as evidence that individuals with different genitalia do not reproduce together, but that does not necessarily mean that individuals with similar genitalia DO reproduce! (l) means narrow and (L) means broad.

· Pits and Tubercles – Some populations of Trogloderus are covered with tubercles (tall bumps) while the rest have pits (small depressions) covering their thorax. No intermediate morphologies are known.

· Dorsal Ridges – The backs of Trogloderus (actually their hardened wings) have longitudinal ridges. There are 4 known morphologies, which have been used in the past for distinguishing different species.

· NOTE: Individuals F and J come from Mono Lake, CA (on the same sand dune on the same night). They represent two different morphologies which are both known to persist there, and there are no known intermediates between the two morphologies.

Definitions:

Biological Species Concept A species is composed of groups of actually or potentially interbreeding populations, which are reproductively isolated from such other groups.

Phenetic Species Concept A species is a cluster of phenotypically similar individuals or populations which is distinct from other such clusters.

Phylogenetic Species Concept A species is the smallest monophyletic group distinguished by a shared derived character.

Evolutionary Species Concept A species is a lineage of populations which maintains its identity from other such lineages and which has its own evolutionary tendencies and historical fate.

Free Chegg AnswerFor More Chemistry Notes and Helpful Content Subscribe Our YouTube Chanel - Chemistry Explain  

Free Chegg Answer

#494 Track the ingestion and digestion of a ham

Track the ingestion and digestion of a ham - Biology

ChemistryExplain daily providing Q&A content “#494 Track the ingestion and digestion of a ham" in Biology scientists, Cell and molecular biology, Molecular and cellular biology, Biology, Ap biology review, Apologia biology

Get the Free Online Chemistry Q&A Questions And Answers with explain. To crack any examinations and Interview tests these Chemistry Questions And Answers are very useful. Here we have uploaded the Free Online Chemistry Questions. Here we are also given the all chemistry topic.

 ChemistryExplain team has covered all Topics related to inorganic, organic, physical chemistry, and others So, Prepare these Chemistry Questions and Answers with Explanation Pdf.

For More Chegg Questions

• Inorganic Chemistry
• Organic Chemistry
• Physical Chemistry

Free Chegg Question

Track the ingestion and digestion of a ham-and-cheese sandwich on whole wheat bread with lettuce, green pepper, and tomatoes. Describe the fate of this sandwich from the time you eat it. Be very detailed regarding the digestive process, location, enzyme action, and use of accessory organs of digestion

Free Chegg AnswerFor More Chemistry Notes and Helpful Content Subscribe Our YouTube Chanel - Chemistry Explain  

Free Chegg Answer

First, let us focus on the constituents of the Ham and cheese sandwich, Ham is a source of protein, cheese contains saturated fat and protein and calcium. Brown bread has carbohydrates and other nutrients.

Let's start the process of digestion.

first, as soon as a bite of the sandwich is taken the salivary glands produce saliva which moistens and softens the food, ptyalin of the saliva breaks the starch component of the sandwich and converts it into disaccharides.

From here the chewed sandwich through the esophagus reaches the stomach.

Gastric juices present in the stomach play a significant role in protein digestion. The action of hydrochloric acid activates certain enzymes now the sandwich in the stomach is acted upon by various protein-digesting enzymes like pepsin.

pepsin acts on the protein and breaks the protein in the ham into peptones and proteases. Apart from this mechanical digestion through the pounding action occurs in the stomach so the sandwich is partially digested by the action of these enzymes.

From the stomach through the pyloric valve chyme passes into the small intestine.

The small intestine receives secretions from the liver and pancreas

The sandwich had cheese which is saturated fat, the bile salts released from the liver helps in the emulsification of fats. so the cheeses are emulsified and the acidity of the chyme is made alkaline by the bile.

The Ham which is high in protein will be exposed to many proteolytic enzymes from the pancreatic juice. the meat is exposed to trypsin, chymotrypsin, carboxypeptidases which act on the Ham and convert it into simple peptides and proteoses.

The steapsin present in the pancreatic juice acts on the emulsified fat of the cheese and converts it into fatty acid and glycerol.

Now the carbohydrate portion of the bread is digested by the sucrase, maltase, lactase enzymes present in the intestinal juices which convert them into glucose and it is absorbed through the intestinal wall.

So the digestion of the carbohydrate, Fats, Proteins occurs in the small intestine. the undigested food now enters the large intestine and the sandwich also had lettuce which is the cellulose part of the food is decomposed by the symbiotic bacteria and the remaining carbohydrates are fermented releasing hydrogen and methane.

and finally, the faces are formed and release outside.

#478 Your lab head has interpreted your univariate

Your lab head has interpreted your univariate - Biology

ChemistryExplain daily providing Q&A content “#478 Your lab head has interpreted your univariate" in Biology scientists, Cell and molecular biology, Molecular and cellular biology, Biology, Ap biology review, Apologia biology

Get the Free Online Chemistry Q&A Questions And Answers with explain. To crack any examinations and Interview tests these Chemistry Questions And Answers are very useful. Here we have uploaded the Free Online Chemistry Questions. Here we are also given the all chemistry topic.

 ChemistryExplain team has covered all Topics related to inorganic, organic, physical chemistry, and others So, Prepare these Chemistry Questions and Answers with Explanation Pdf.

For More Chegg Questions

• Inorganic Chemistry
• Organic Chemistry
• Physical Chemistry

Free Chegg Question

As a recent graduate of RMIT University you have just been employed (3-year contract) by a world-renowned infectious diseases institute located in Victoria, Australia. You are required to investigate the effects of the novel small molecule anti-viral (DAD030981) to determine the global metabolic changes which take place in the tissue of lungs of monkeys infected by SARSCoV-2 (Infected Group) vs the tissue of lungs of healthy monkeys (Control Group). You have been asked by your laboratory head to design and carry out a “metabolomics experiment.”

Q5. Your lab head has interpreted your univariate data and noticed that amino acid metabolism appears to be downregulated in the infected group relative to the control group. Your lab head has now asked you to perform a Principal Component Analysis (multivariate analysis).

1-Briefly illustrate or describe how your Principal Component Analysis would look like.

2-What causes your control and infected groups to be separated in three-dimensional space?

Free Chegg AnswerFor More Chemistry Notes and Helpful Content Subscribe Our YouTube Chanel - Chemistry Explain  

Free Chegg Answer

PCA - ( Principal component analysis) has been used to visualise high dimensional metabolic data in a two or three dimensional subspace

In metabolomics, metabolites are specifically choosen based on their rank, (that is,. Like first 10) and have subsequently selected when using factor loading in PCA and biological interference are made for These metabolites.

A statistical approach is made that selects metabolites with statistical hypothesis testing of the factor which is loaded in PCA which makes biological interference about MESA (metabolic set enrichment analysis).

2. This entire process depends on factors that eigonvector PCA in autoscale data is proportional to coefficient of correlation between PC score and each metabolite.

#477 What experimental design would you propose

What experimental design would you propose - Biology

ChemistryExplain daily providing Q&A content “#477 What experimental design would you propose" in Biology scientists, Cell and molecular biology, Molecular and cellular biology, Biology, Ap biology review, Apologia biology

Get the Free Online Chemistry Q&A Questions And Answers with explain. To crack any examinations and Interview tests these Chemistry Questions And Answers are very useful. Here we have uploaded the Free Online Chemistry Questions. Here we are also given the all chemistry topic.

 ChemistryExplain team has covered all Topics related to inorganic, organic, physical chemistry, and others So, Prepare these Chemistry Questions and Answers with Explanation Pdf.

For More Chegg Questions

• Inorganic Chemistry
• Organic Chemistry
• Physical Chemistry

Free Chegg Question

As a recent graduate ofRMIT University you have just been employed (3-year contract) by a world-renownedinfectious diseases institute located in Victoria, Australia. You are requiredto investigate the effects of the novel small moleculeanti-viral (DAD030981)to determinetheglobalmetabolic changes which take place in the tissue of lungs of monkeys infected bySARS-CoV-2(Infected Group)vs the tissue of lungsof healthy monkeys (Control Group). You have been asked by your laboratory head to designand carry out a “metabolomics experiment.”

Q1. What experimental design would you propose to your lab head? He will first need to approve this and then discuss with you how you are going to prepare samples and analyse them before you begin.What kind of metabolomics approach will you propose to your lab head and why?What considerations with respect to your experimental design should you propose?

Free Chegg AnswerFor More Chemistry Notes and Helpful Content Subscribe Our YouTube Chanel - Chemistry Explain  

Free Chegg Answer

To design the experiment, the monkeys will be divided into three groups,

Group I: Monkeys infected with SARS CoV2 receiving molecule anti-viral

Group II: Mokeys infected with SARS CoV2 not receiving molecule anti-viral

Group II: Monekys not infected with SARS CoV2 (Control Group)

To study the metabolic changes in the lung in response to the infection and the anti-viral molecule in comparison to control the follwoing parameters and tests could be evaluated:

1. Level of gases in the blood: Measure Arterial Blood Gas

2. Blood pH: To understand metabolic/ respiratory acidosis/alkalosis

3. Lung function test using spirometry: Respiratory rate/tidal volume etc.

4. Study cytokine levels in blood to undertand the acute inflammation in response to the virus.

5. X-Ray or CT imaging of lungs to understand status of pneumonia and fibrosis

6. Blood clotting factors using D-Dymer and P-time.

7. Prepare tissue samples to study varioations in enzyme activites involved in lung metabolic functions

8. Use IHC to score the number and activation status of alveolar macrophages.

9 Use histology and SEM to study changes in tissue structure, fibrosis and cell death.

11. Data analysis and statistics

Some of the concerns regarding the experiment would involve sample size. A larger sample size would ensure better statistical significance of data, Also the statistical tools used for data analysis need to be carefully chosen. In imgaing experiments blinded scoring is important to perform comparitive study among groups.

#471 You are required to investigate the effects

You are required to investigate the effects - Biology

ChemistryExplain daily providing Q&A content “#471 You are required to investigate the effects" in Biology scientists, Cell and molecular biology, Molecular and cellular biology, Biology, Ap biology review, Apologia biology'

Get the Free Online Chemistry Q&A Questions And Answers with explain. To crack any examinations and Interview tests these Chemistry Questions And Answers are very useful. Here we have uploaded the Free Online Chemistry Questions. Here we are also given the all chemistry topic.

 ChemistryExplain team has covered all Topics related to inorganic, organic, physical chemistry, and others So, Prepare these Chemistry Questions and Answers with Explanation Pdf.

For More Chegg Questions

• Inorganic Chemistry
• Organic Chemistry
• Physical Chemistry

Free Chegg Question

As a recent graduate of RMIT University you have just been employed (3-year contract) by a world-renowned infectious diseases institute located in Victoria, Australia. You are required to investigate the effects of the novel small molecule anti-viral (DAD030981) to determine the global metabolic changes which take place in the tissue of lungs of monkeys infected by SARS- CoV-2 (Infected Group) vs the tissue of lungs of healthy monkeys (Control Group). You have been asked by your laboratory head to design and carry out a “metabolomics experiment.” Q1. What experimental design would you propose to your lab head? He will first need to approve this and then discuss with you how you are going to prepare samples and analyse them before you begin. What kind of metabolomics approach will you propose to your lab head and why? What considerations with respect to your experimental design should you propose?

Free Chegg AnswerFor More Chemistry Notes and Helpful Content Subscribe Our YouTube Chanel - Chemistry Explain  

Free Chegg Answer

Case control experiment wiould be proposed  to the lab head.  Case control experiment will be used to assess the potential risk related to anti-viral (DAD030981) in the tissue of lungs of monkeys infected by SARS-CoV-2 (Infected group) vs the tissue of lungs of healthy monkeys (Control Group).

Proposed metabolic approach

Both groups of the subjects will be kept separately to prevent the cross infection first. The number individuals in each groups will be according to the requirement of statistical method.

Dose of the anti-viral (DAD030981) drug will be decided first for both groups according to the assessment of toxicity and efficacy.

I will go for statistical analysis to determine the actual effect of anti-viral (DAD030981) drug. The significant and non-significant effect of the anti-viral (DAD030981) drug will be analysed by testing the null hypothesis through analysis of variance method.

#466 Your lab head has interpreted your univariate

Your lab head has interpreted your univariate - Biology

ChemistryExplain daily providing Q&A content “#466 Your lab head has interpreted your univariate" in Biology scientists, Cell and molecular biology, Molecular and cellular biology, Biology, Ap biology review, Apologia biology

Get the Free Online Chemistry Q&A Questions And Answers with explain. To crack any examinations and Interview tests these Chemistry Questions And Answers are very useful. Here we have uploaded the Free Online Chemistry Questions. Here we are also given the all chemistry topic.

 ChemistryExplain team has covered all Topics related to inorganic, organic, physical chemistry, and others So, Prepare these Chemistry Questions and Answers with Explanation Pdf.

For More Chegg Questions

• Inorganic Chemistry
• Organic Chemistry
• Physical Chemistry

Free Chegg Question

As a recent graduate of RMIT University you have just been employed (3-year contract) by a world-renowned infectious diseases institute located in Victoria, Australia. You are required to investigate the effects of the novel small molecule anti-viral (DAD030981) to determine the global metabolic changes which take place in the tissue of lungs of monkeys infected by SARSCoV-2 (Infected Group) vs the tissue of lungs of healthy monkeys (Control Group). You have been asked by your laboratory head to design and carry out a “metabolomics experiment.”

Q5. Your lab head has interpreted your univariate data and noticed that amino acid metabolism appears to be downregulated in the infected group relative to the control group. Your lab head has now asked you to perform a Principal Component Analysis (multivariate analysis). 1-Briefly illustrate or describe how your Principal Component Analysis would look like.

2-What causes your control and infected groups to be separated in three-dimensional space?

Free Chegg AnswerFor More Chemistry Notes and Helpful Content Subscribe Our YouTube Chanel - Chemistry Explain  

Free Chegg Answer

1.The principle component analysis is a broadly utilized solo information decrease strategy. Here, in this undertaking, the objective of applying PCA technique is to features the comparability and disparity in the gathered basic and energy profile of Molecular docking(MD) direction information. Utilizing this procedure, any basic quality change during MD can be portrayed by looking at changed medication protein buildings. The accompanying condition features the significant parts of a PCA model: where, X framework is communicated as a result of two new lattices, for example Tk and Pk, Tk fills in as the lattice of scores that speaks to how tests identify with one another, Pk speaks to the framework of loadings which contain data about how factors identify with one another, k is the quantity of components remembered for the model, and E is the network of residuals.

These residuals contain the unmodeled differences. Edifices of the fundamental protease with the chose five phytochemicals may have contrasts with the principle protease, for example apo-protein, during MD recreations regarding basic and energy profile. These distinctions can be recognized by the PCA calculation. All estimations were performed on R stage utilizing in-house created codes, and plots were produced utilizing the bundle ggplot2. Information were preprocessed utilizing autoscale work before applying PCA calculation.

PCA is utilized to dissect the auxiliary and energy information got from MD reenactment on protein-phytochemical edifices and apo-protein. Bond separations, bond points, dihedral points, planarity, Van der Waals and electrostatic energies were incorporated as factors. The PCA score plot uncovers various bunches development. Among these bunches, α-ketoamide-11r-protein complex (red), cyanidin 3-glucoside-protein complex (blue), and the apo-protein (dark) are covered. Stacking plot of the PCA uncovers that the dihedral point energies show positive connection with these three gatherings. Baicalin-protein complex (green) exhibits comparative examples to α-ketoamide-11r and cyanidin 3-glucoside edifices in the score plot, despite the fact that the energy dispersion of baicalin is more extensive contrasted with the other two buildings. The fluctuating idea of baicalin-protein complex in the MD reproduction could be the purpose behind its more extensive conveyance in the score plot. Be that as it may, it tends to be considered as a likely up-and-comer. The hypericin-protein complex displays critical contrast contrasted with the other medication protein buildings by framing a particular bunch (fuchsia). This is sensible as hypericin shows the most elevated deviation during complex arrangement contrasted with different applicants. The glabridin-protein complex is additionally shaped an unmistakable group (cyan) in the score plot.

2. Since in infected individuals amino acid metabolism is downregulated therefore on PCA also two groups can be clearly seen as one group infected other is control with normal amino acid metabolism.

#465 You are required to investigate the effects

You are required to investigate the effects - Biology

ChemistryExplain daily providing Q&A content “#465 You are required to investigate the effects" in Biology scientists, Cell and molecular biology, Molecular and cellular biology, Biology, Ap biology review, Apologia biology

Get the Free Online Chemistry Q&A Questions And Answers with explain. To crack any examinations and Interview tests these Chemistry Questions And Answers are very useful. Here we have uploaded the Free Online Chemistry Questions. Here we are also given the all chemistry topic.

 ChemistryExplain team has covered all Topics related to inorganic, organic, physical chemistry, and others So, Prepare these Chemistry Questions and Answers with Explanation Pdf.

For More Chegg Questions

• Inorganic Chemistry
• Organic Chemistry
• Physical Chemistry

Free Chegg Question

You are required to investigate the effects of the novel small molecule anti-viral (DAD030981) to determine the global metabolic changes which take place in the tissue of lungs of monkeys infected by SARS-CoV-2 (Infected Group) vs the tissue of lungs of healthy monkeys (Control Group). You have been asked by your laboratory head to design and carry out a “metabolomics experiment.”

Q1. Your laboratory head has asked you to briefly prepare an experimental design so he can first approve this and then discuss with you how you are going to prepare samples and analyse them. What kind of metabolomics approach has your lab head suggested and why? What considerations with respect to your experimental design should you propose?

So what type of Metabolomics tests would we be using in this experiment? how would we determine if the infected group was actually infected?

Free Chegg AnswerFor More Chemistry Notes and Helpful Content Subscribe Our YouTube Chanel - Chemistry Explain  

Free Chegg Answer

There are two approaches in metabolomics:

1. Targeted approach

2. Untargeted approach

Targeted approach measures the set of metabolites to address specific biochemical question.

Untargeted approach, also called as global approach measures as many metabolites as possible from a range of biological samples without any bias.

The experimental requirement in the question needs the utilization of targeted approach.

Workflow for both the approaches is as follows:

Designing of the experiment.--> Sample Preparation --> Chromatography -->Mass Spectrometry -->Data acquisition --> Data processing --> Analysis and Imterpretation

Experimental Design:

Factors that can affect the experiment have to be eliminated or identified so that they can be accounted for during data analysis. Other factors like sample size, randomisation, and storage helps in producing reproducible and successful experiments that minimise erroneous variability.

Noise error during the handling of experiments should also be considered.

Sample Preparation:

It imvolves collection, storage, extraction and preparation of the sample for the individual measurement system

In most case, solid case extraction system is preferred in metabolomics studies.

Mass spectrometry (MS) :

It is an analytical technique used to measure small molecules.

The analytes are ionised at an ion source before they can be detected in a coupled mass detector.

The resulting data typically consists of mass-to-charge (m/z), time, and intensity triplets that describe – for every detected ion mass – the strength of the ion beam and the time it is detected by the spectrometer.

Data processing:

Data processing aims to extract biologically relevant information from the acquired data. It includes many steps that are similar for MS.

Noise (or error) is an important consideration to factor in because it distorts the signals in your data. There are two types of noise:

Random noise: results from contaminants and general technological limitations.

Systematic noise: results from external factors that are not relevant for the study. Baseline drift is one example of systematic noise and is a common problem in liquid chromatography-mass spectrometry (LC-MS) where the gradient of the mobile phase causes the chromatographic baseline to be irregular.

Analysis and Interpretation:

The goal of statistical analysis is the categorisation and prediction of sample properties through generation of models that capture the information contained in data matrices.

The dimensionality-reduction methods can be used in classification, regression, and prediction exercises.

The quality of the statistical models that we infer depends significantly on the data pre-processing, scaling and normalisation methods used

#463 As a recent graduate of RMIT University

As a recent graduate of RMIT University - Biology

ChemistryExplain daily providing Q&A content “#463 As a recent graduate of RMIT University" in Biology scientists, Cell and molecular biology, Molecular and cellular biology, Biology, Ap biology review, Apologia biology

Get the Free Online Chemistry Q&A Questions And Answers with explain. To crack any examinations and Interview tests these Chemistry Questions And Answers are very useful. Here we have uploaded the Free Online Chemistry Questions. Here we are also given the all chemistry topic.

 ChemistryExplain team has covered all Topics related to inorganic, organic, physical chemistry, and others So, Prepare these Chemistry Questions and Answers with Explanation Pdf.

For More Chegg Questions

• Inorganic Chemistry
• Organic Chemistry
• Physical Chemistry

Free Chegg Question

As a recent graduate of RMIT University you have just been employed (3-year contract) by a world-renowned infectious diseases institute located in Victoria, Australia. You are required to investigate the effects of the novel small molecule anti-viral (DAD030981) to determine the global metabolic changes which take place in the tissue of lungs of monkeys infected by SARSCoV-2 (Infected Group) vs the tissue of lungs of healthy monkeys (Control Group). You have been asked by your laboratory head to design and carry out a “metabolomics experiment.”

Q3. Your lab head has now asked you to analyse the polar metabolite extract on the laboratory’s GC-MS.

Briefly describe how it may be possible to analyse polar metabolites on the GC-MS.

What additional sample should you run with you experiment and why?

Free Chegg AnswerFor More Chemistry Notes and Helpful Content Subscribe Our YouTube Chanel - Chemistry Explain  

Free Chegg Answer

GC-MS analysis is a highly sensitive technique used to identify target and non target metabolomics of complex biological samples that play crucial roles in cellular Dynamics. GC can analysis even trace amount of non polar, polar and volatile compounds. There are limitations to analyse polar compounds due to their low volatile nature and thermoliability. In the presalting target metabolomics, the polar compounds will also be eluted alone with the salt. To prevent this, the amine,the thiol, or hydroxyl groups of polar metabolites are derivatized with trimethylsilyl (TMS) derivatives and tert-butyldimethylsilyl (TBDMS) which would increase the stability and volatility of metabolites.

#436 In the following diagram, characterize the

In the following diagram, characterize the - Biology

ChemistryExplain daily providing Q&A content “#436 In the following diagram, characterize the" in Biology scientists, Cell and molecular biology, Molecular and cellular biology, Biology, Ap biology review, Apologia biology

Get the Free Online Chemistry Q&A Questions And Answers with explain. To crack any examinations and Interview tests these Chemistry Questions And Answers are very useful. Here we have uploaded the Free Online Chemistry Questions. Here we are also given the all chemistry topic.

 ChemistryExplain team has covered all Topics related to inorganic, organic, physical chemistry, and others So, Prepare these Chemistry Questions and Answers with Explanation Pdf.

For More Chegg Questions

• Inorganic Chemistry
• Organic Chemistry
• Physical Chemistry

Free Chegg Question

In the following diagram, characterize the type of disorder illustrated in the pedigree analysis below. Make sure to label everyone by genotype and indicate the type of pedigree analysis

Free Chegg AnswerFor More Chemistry Notes and Helpful Content Subscribe Our YouTube Chanel - Chemistry Explain  

Free Chegg Answer

The given Pedigree is showing a sex linked recessive trait. It is because the affected mother of first generation it transferring the trait to all the sons. It is because son gets X chromosome always from the mother and never from the father.

Females get one chromosome from mother and one chromosome from father and therefore in order to be affected from X linked recessive trait, the father must be affected and the mother should be carrier or affected.

In this case, the daughters seem to be either carrier or absolutely normal in the second generation.

#434 As a recent graduate of RMIT University you

As a recent graduate of RMIT University you - Biology

ChemistryExplain daily providing Q&A content “#434 As a recent graduate of RMIT University you" in Biology scientists, Cell and molecular biology, Molecular and cellular biology, Biology, Ap biology review, Apologia biology

Get the Free Online Chemistry Q&A Questions And Answers with explain. To crack any examinations and Interview tests these Chemistry Questions And Answers are very useful. Here we have uploaded the Free Online Chemistry Questions. Here we are also given the all chemistry topic.

 ChemistryExplain team has covered all Topics related to inorganic, organic, physical chemistry, and others So, Prepare these Chemistry Questions and Answers with Explanation Pdf.

For More Chegg Questions

• Inorganic Chemistry
• Organic Chemistry
• Physical Chemistry

Free Chegg Question

As a recent graduate of RMIT University you have just been employed (3-year contract) by a world-renowned infectious diseases institute located in Victoria, Australia. You are required to investigate the effects of the novel small molecule anti-viral (DAD030981) to determine the global metabolic changes which take place in the tissue of lungs of monkeys infected by SARS- CoV-2 (Infected Group) vs the tissue of lungs of healthy monkeys (Control Group). You have been asked by your laboratory head to design and carry out a “metabolomics experiment.”

Q1. What experimental design would you propose to your lab head? He will first need to approve this and then discuss with you how you are going to prepare samples and analyse them before you begin.

What kind of metabolomics approach will you propose to your lab head and why? What considerations with respect to your experimental design should you propose?

Q2. Congratulations! Your lab head has approved your project and has now asked you to provide details as to how you are going to prepare samples for your metabolomics experiment.

Briefly describe your proposed sample preparation workflow ONLY and provide a justification for each step.

What kind of internal standard do you propose to use and why?
Q3. Your lab head has now asked you to analyse the polar metabolite extract on the laboratory’s GC-MS.

Briefly describe how it may be possible to analyse polar metabolites on the GC-MS. What additional sample should you run with you experiment and why?

Q4. Your lab head is quite pleased that you have acquired all data in such a short amount of time and is now eager for you to analyse the data.

Briefly explain what and why deconvolution is important in appropriately identifying metabolites.

How can your lab head determine which metabolites are up and/or down regulated? How can your lab head determine which metabolites are statistically significant?

Free Chegg AnswerFor More Chemistry Notes and Helpful Content Subscribe Our YouTube Chanel - Chemistry Explain  

Free Chegg Answer

Dear student due to less time provided for solve we are advised to solve 1st Question when multiple Questions are uploaded (Chegg minimum answer policy). Your question is quite lengthy too. Hence i am solving the first part only. For the rest of the Question please upload it seperately.

Q 1) experimental design I would propose to my lab head would be -

Isolate the SARS COV-2 by aerosol or mucous fr mild clinical exposure . Here ,Factors that can affect the experiment have to be eliminated or identified so that they can be accounted for during data analysis. sample size, randomisation, and storage helps in producing reproducible and successful experiments that minimise erroneous variability.

Here ,There are two approaches in metabolomics:

1. Targeted approach

2. Untargeted approach

Targeted approach measures the set of metabolites to address specific biochemical question.

Untargeted approach, also called as global approach measures as many metabolites as possible from a range of biological samples without any bias.

• Workflow for both the approaches is as follows:
• Designing of the experiment.--> Sample Preparation --> Chromatography -->Mass Spectrometry -->Data acquisition --> Data processing --> Analysis and Imterpretation.

Sample Preparation:

It involves collection, storage, extraction and preparation of the sample for the individual measurement system

In most case, solid case extraction system is preferred in metabolomics studies.

Mass spectrometry (MS) :

It is an analytical technique used to measure small molecules.

The analytes are ionised at an ion source before they can be detected in a coupled mass detector.

Data processing:

Data processing aims to extract biologically relevant information from the acquired data. It includes many steps that are similar for MS. The random and systematic noise both are eliminated.

Analysis and Interpretation:It is done for categorisation , regression and prediction of the properties of the sample.

#316 A brown male mouse is mated with

A brown male mouse is mated with - Biology

ChemistryExplain daily providing Q&A content “#316 A brown male mouse is mated with" in Biology scientists, Cell and molecular biology, Molecular and cellular biology, Biology, Ap biology review, Apologia biology

Get the Free Online Chemistry Q&A Questions And Answers with explain. To crack any examinations and Interview tests these Chemistry Questions And Answers are very useful. Here we have uploaded the Free Online Chemistry Questions. Here we are also given the all chemistry topic.

 ChemistryExplain team has covered all Topics related to inorganic, organic, physical chemistry, and others So, Prepare these Chemistry Questions and Answers with Explanation Pdf.

For More Chegg Questions

• Inorganic Chemistry
• Organic Chemistry
• Physical Chemistry

Free Chegg Question

A brown male mouse is mated with two female black mice. In several litters of young, the first female has had 48 black and the second female has had 14 black and 11 brown young. Can you deduce the pattern of inheritance of coat color and the genotypes of the parents?

For More Chemistry Notes and Helpful Content Subscribe Our YouTube Chanel - Chemistry Explain  

Free Chegg Answer

1. Step 1 of 2

   Brown male mouse is mated with two female black mice. The first female has 48 black mice while the second female has 14 black and 11 brown young.

   From the above result it can be deduced that: the gene for black coat is dominant (B) while the gene for brown coat is recessive (b).

   In the first case, both the parents are homozygous.

   Genotype of brown male is: b/b

   Genotype of black female mouse is: B/B

   The cross with first female:

    

   b/b x B/B

   

   F1 generation: B/b or all the young in the litter are black.

2. Step 2 of 2

   In the second cross between brown male mouse (b/b) and second black female mouse (B/b) the female is heterozygous.

   The cross with second female mice is:

   b/b x B/b

   

   So in F1 generation nearly half of the young are brown and the other half are black.

#303 Gene Directionality Glucose transported across

Gene Directionality Glucose transported across - Biology

ChemistryExplain daily providing Q&A content “#303 Gene Directionality Glucose transported across" in Biology scientists, Cell and molecular biology, Molecular and cellular biology, Biology, Ap biology review, Apologia biology

Get the Free Online Chemistry Q&A Questions And Answers with explain. To crack any examinations and Interview tests these Chemistry Questions And Answers are very useful. Here we have uploaded the Free Online Chemistry Questions. Here we are also given the all chemistry topic.

 ChemistryExplain team has covered all Topics related to inorganic, organic, physical chemistry, and others So, Prepare these Chemistry Questions and Answers with Explanation Pdf.

For More Chegg Questions

• Inorganic Chemistry
• Organic Chemistry
• Physical Chemistry

Free Chegg Question

Gene Directionality Glucose transported across the cell membrane in Escherichia coli can be phosphorylated by glucose kinase (encoded by glk) and is the first committed step in glycolysis.

Q1. The arrow above indicates the direction of the gene. Will glik be transcribed left-to-right or right-to-left?

Q2. Is the sequence above the coding strand or template strand?

Q3. What is the base pair position number for the start codon?

Q4. What is the bato pair position number for the stop codon?

Q5. Do you expect the terminator to be on the 5' end or 3' end of the given sequence?

Q6. What is the base pair position number for the - 10 element?

Q7. How many base pairs are in the open reading frame?

Q8. What are the last 3 amino acids and how many amino acids does the open reading frame of gik encode for?

Hairpin Loop Termination

Hairpin Loop Termination In the glk example, RNA polymerase stops transcription via a hairpin. Circle/highlight the inverted repeat sequence for the following DNA coding strain and explain why this terminates transcription.

DNA coding strain 5' CGAAAGGCTACTTTTGTAGCCTTTTTTTT3

 For More Chemistry Notes and Helpful Content Subscribe Our YouTube Chanel - Chemistry Explain  

Free Chegg Answer

1). The glk will be transcribed in right to left direction. As the the 5' position of transcribing mRNA would come parallel to 3'-end of gene.

2). The given strand is template strand. As, the arrow is indicating direction of gene, which is from 3' to 5'. On this strand, mRNA will be synthesized from 5' to 3' direction.

3). The start codon (TAC) is present at the number 1028 to 1026

4). The stop codon (ATT) is present at the number 64 to 62

5). The terminator would be present on the 5'-end and promotor at 3'-end because it is a template strand and transcription starts from 3' end to 5' end.

#237 What factors may have led the medical

What factors may have led the medical - Biology

ChemistryExplain daily providing Q&A content “#237 What factors may have led the medical" in Biology scientists, Cell and molecular biology, Molecular and cellular biology, Biology, Ap biology review, Apologia biology

Get the Free Online Chemistry Q&A Questions And Answers with explain. To crack any examinations and Interview tests these Chemistry Questions And Answers are very useful. Here we have uploaded the Free Online Chemistry Questions. Here we are also given the all chemistry topic.

 ChemistryExplain team has covered all Topics related to inorganic, organic, physical chemistry, and others So, Prepare these Chemistry Questions and Answers with Explanation Pdf.

For More Chegg Questions

• Inorganic Chemistry
• Organic Chemistry
• Physical Chemistry

Free Chegg Question

What factors may have led the medical staff to suspect that Ms. Singh had more than a very bad cold? Would you have come to the same conclusion?

 For More Chemistry Notes and Helpful Content Subscribe Our YouTube Chanel - Chemistry Explain  

Free Chegg Answer

Step 1 of 2

1. Johti Singh is a middle-aged woman who has a medical history of having the bad cold for many weeks, which is still persistent. The primary assessment of any patient with respiratory problems involves the health history of the client, her physical examination and performing various diagnostic procedures.

   Ms. Singh has been a consistent cigarette smoker for a long time. She also showed the signs of rapid respirations, adventitious and diminished breath sounds and appearance of thick yellow sputum. These symptoms depict the condition of ineffective airway clearance. Also, she has been diagnosed with pneumonia.

   Step 2 of 2

2. Other abnormal signs such as elevated temperature, rapid, labored respirations, fatigue and mild dehydration are also reported. These observations reveal a condition, which is more serious than a bad cold. A bad cold is not supposed to extend for such a long time and should not be accompanied with pneumonia.