#303 Gene Directionality Glucose transported across

Gene Directionality Glucose transported across - Biology

ChemistryExplain daily providing Q&A content “#303 Gene Directionality Glucose transported across" in Biology scientists, Cell and molecular biology, Molecular and cellular biology, Biology, Ap biology review, Apologia biology

Get the Free Online Chemistry Q&A Questions And Answers with explain. To crack any examinations and Interview tests these Chemistry Questions And Answers are very useful. Here we have uploaded the Free Online Chemistry Questions. Here we are also given the all chemistry topic.

 ChemistryExplain team has covered all Topics related to inorganic, organic, physical chemistry, and others So, Prepare these Chemistry Questions and Answers with Explanation Pdf.

For More Chegg Questions

• Inorganic Chemistry
• Organic Chemistry
• Physical Chemistry

Free Chegg Question

Gene Directionality Glucose transported across the cell membrane in Escherichia coli can be phosphorylated by glucose kinase (encoded by glk) and is the first committed step in glycolysis.

Q1. The arrow above indicates the direction of the gene. Will glik be transcribed left-to-right or right-to-left?

Q2. Is the sequence above the coding strand or template strand?

Q3. What is the base pair position number for the start codon?

Q4. What is the bato pair position number for the stop codon?

Q5. Do you expect the terminator to be on the 5' end or 3' end of the given sequence?

Q6. What is the base pair position number for the - 10 element?

Q7. How many base pairs are in the open reading frame?

Q8. What are the last 3 amino acids and how many amino acids does the open reading frame of gik encode for?

Hairpin Loop Termination

Hairpin Loop Termination In the glk example, RNA polymerase stops transcription via a hairpin. Circle/highlight the inverted repeat sequence for the following DNA coding strain and explain why this terminates transcription.

DNA coding strain 5' CGAAAGGCTACTTTTGTAGCCTTTTTTTT3

 For More Chemistry Notes and Helpful Content Subscribe Our YouTube Chanel - Chemistry Explain  

Free Chegg Answer

1). The glk will be transcribed in right to left direction. As the the 5' position of transcribing mRNA would come parallel to 3'-end of gene.

2). The given strand is template strand. As, the arrow is indicating direction of gene, which is from 3' to 5'. On this strand, mRNA will be synthesized from 5' to 3' direction.

3). The start codon (TAC) is present at the number 1028 to 1026

4). The stop codon (ATT) is present at the number 64 to 62

5). The terminator would be present on the 5'-end and promotor at 3'-end because it is a template strand and transcription starts from 3' end to 5' end.